Journal: Cureus

Article Title: Investigation of the Use of Circulating Long Non-coding RNA HOXA Transcript at the Distal Tip (LncRNA HOTTIP) as a Biomarker in Breast Cancer

doi: 10.7759/cureus.50019

Figure Lengend Snippet: HOTTIP values (arbitrary units) In science and technology, an arbitrary unit or procedure defined unit is a relative unit of measurement that shows the ratio of amount of substance or other quantities to a predetermined reference measurement. HOTTIP: HOXA transcript at the distal tip, GAPDH: glyceraldehyde-3-phosphate dehydrogenase (used as an endogenous control for quantitative RT-PCR analysis because its expression is consistent at different time points and various experimental manipulations), CT: threshold cycle for each sample for each gene expression measured, ΔCT: CT HOTTIP - CT GAPDH, ΔΔCT: ΔCT sample - ΔCT pool, 2^(-ΔΔCT): standard strategy for qPCR data analysis based on the PCR efficiency

Article Snippet: The levels of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were estimated in the same samples using the respective predesigned primers - TaqMan probe set (Hs03929097_g1, Thermo Fisher Scientific) - and served as a housekeeping gene.

Techniques: Control, Quantitative RT-PCR, Expressing, Gene Expression

Journal: Neurotherapeutics

Article Title: Alterations in Gene and Protein Expression of Cannabinoid CB 2 and GPR55 Receptors in the Dorsolateral Prefrontal Cortex of Suicide Victims

doi: 10.1007/s13311-018-0610-y

Figure Lengend Snippet: CB2r A isoform and GPR55 gene expression analyses in the DLPFC of suicide victims by real-time PCR. (A. and B.) Total RNA integrity number (RIN) evaluation in the DLPFC of suicide victims and control subjects: (A.) Representative electropherogram images of mean RIN values from DLPFC, (B.) RIN values summary table, gray boxes contain global mean values ± SEM. (C.) Relative gene expression of CB2r A isoform and (D.) GPR55 gene expression in DLPFC of suicide victims (n = 18) and their corresponding control group (n = 15). Asterisks indicate values from suicide victims that are significantly different (p < 0.05) from control subjects. Columns represent the mean and the vertical line ± the standard error of the mean (SEM) of 2-ΔΔCt

Article Snippet: Relative CB 2 r A isoform and GPR55 gene expression levels were measured using Taqman Gene Expression Assays (CB 2 r A isoform primer pair and probe were as follows: forward, GGAAGAAAGAGAATATTGTTCAGTTGATT, reverse, GCTGGCCTTGGAGAGTGACA, MGB Taqman probe, CCAGATGCAGCCGC; GPR55 Mm02621622_m1) [ 45 ] as a double-stranded DNA-specific fluorescent dye and performed on the StepOne Sequence Detector System (Applied Biosystems, Madrid, Spain).

Techniques: Gene Expression, Real-time Polymerase Chain Reaction, Control

Journal: Neurotherapeutics

Article Title: Alterations in Gene and Protein Expression of Cannabinoid CB 2 and GPR55 Receptors in the Dorsolateral Prefrontal Cortex of Suicide Victims

doi: 10.1007/s13311-018-0610-y

Figure Lengend Snippet: Protein expression analyses of CB2r and GPR55 in DLPFC suicide victims by western blot. (A.) Protein expression levels of CB2r and (B.) GPR55 in DLPFC of suicide victims (n = 18) and their corresponding control group (n = 15). Representative immunoblots of (C.) CB2r and (D.) GPR55 protein expression. Asterisks indicate values from suicide victims that are significantly different (p < 0.05) from control subjects. Data are expressed as mean ± SEM of arbitrary units (A.U)

Article Snippet: Relative CB 2 r A isoform and GPR55 gene expression levels were measured using Taqman Gene Expression Assays (CB 2 r A isoform primer pair and probe were as follows: forward, GGAAGAAAGAGAATATTGTTCAGTTGATT, reverse, GCTGGCCTTGGAGAGTGACA, MGB Taqman probe, CCAGATGCAGCCGC; GPR55 Mm02621622_m1) [ 45 ] as a double-stranded DNA-specific fluorescent dye and performed on the StepOne Sequence Detector System (Applied Biosystems, Madrid, Spain).

Techniques: Expressing, Western Blot, Control

Journal: Neurotherapeutics

Article Title: Alterations in Gene and Protein Expression of Cannabinoid CB 2 and GPR55 Receptors in the Dorsolateral Prefrontal Cortex of Suicide Victims

doi: 10.1007/s13311-018-0610-y

Figure Lengend Snippet: Pearson coefficient correlation for CB 2 r and GPR55 gene expressions and RIN, PMI, PMR and age variables for controls and suicides cases

Article Snippet: Relative CB 2 r A isoform and GPR55 gene expression levels were measured using Taqman Gene Expression Assays (CB 2 r A isoform primer pair and probe were as follows: forward, GGAAGAAAGAGAATATTGTTCAGTTGATT, reverse, GCTGGCCTTGGAGAGTGACA, MGB Taqman probe, CCAGATGCAGCCGC; GPR55 Mm02621622_m1) [ 45 ] as a double-stranded DNA-specific fluorescent dye and performed on the StepOne Sequence Detector System (Applied Biosystems, Madrid, Spain).

Techniques: Control

Journal: Neurotherapeutics

Article Title: Alterations in Gene and Protein Expression of Cannabinoid CB 2 and GPR55 Receptors in the Dorsolateral Prefrontal Cortex of Suicide Victims

doi: 10.1007/s13311-018-0610-y

Figure Lengend Snippet: CB2-GPR55 receptor heteromer expression in human prefrontal cortex. In situ proximity ligation assays were performed as described in Materials and Methods using control (A, A’, A”) and suicidal (C, C’, C”) human brain sections. A” and C” are magnification images of fields (white-dotted rectangles) in, respectively, A’ and C’. Confocal microscopy images (superimposed sections) are shown; heteromers appear as red clusters and Hoechst-stained nuclei appear in blue. (B) Shows the ratio (number of red spots/cell-containing spots) for the indicated samples. Data are the mean ± SEM of counts in 5–7 different fields (each image covered an area of 59,692 μm2) from every sample from controls (n = 7) or suicidal (n = 6). Student’s t test analysis showed significant inter-group differences on ratio of PLA spots. Asterisks indicate values from suicide victims that are significantly different (p < 0.05) from control subjects. (D) A negative control obtained by omitting one of the primary antibodies is shown. Scale bars: 50 μm (A, A’, C, C′), 10 μM (A”, C”)

Article Snippet: Relative CB 2 r A isoform and GPR55 gene expression levels were measured using Taqman Gene Expression Assays (CB 2 r A isoform primer pair and probe were as follows: forward, GGAAGAAAGAGAATATTGTTCAGTTGATT, reverse, GCTGGCCTTGGAGAGTGACA, MGB Taqman probe, CCAGATGCAGCCGC; GPR55 Mm02621622_m1) [ 45 ] as a double-stranded DNA-specific fluorescent dye and performed on the StepOne Sequence Detector System (Applied Biosystems, Madrid, Spain).

Techniques: Expressing, In Situ, Ligation, Control, Confocal Microscopy, Staining, Negative Control

Journal: Neurotherapeutics

Article Title: Alterations in Gene and Protein Expression of Cannabinoid CB 2 and GPR55 Receptors in the Dorsolateral Prefrontal Cortex of Suicide Victims

doi: 10.1007/s13311-018-0610-y

Figure Lengend Snippet: In situ proximity ligation-based detection of cellular types expressing CB2-GPR55 receptor heteromers. Panel 1A–1D: Expression of CB2-GPR55 receptor heteromers (PLA-detected, red channel) in astrocytes (GFAP immunostain; green channel). TOPRO3-counterstain was used to disclose cell nuclei. 1B and 1D are insets taken from 1A and 1C, respectively, to illustrate the expression of CB2r-GPR55 receptor heteromers in astrocytes. Cortical neurons also expressed heteromeric complexes made of CB2r and GPR55 receptors. Panels 1A–1B were taken from control samples whereas panels 1C–1D belong to suicide cases. Panel 2A–2D: Expression of CB2r-GPR55 receptor heteromers (PLA-detected, red channel) in microglial cells (Iba1 immunostain; green channel). TOPRO3-counterstain was used to disclose cell nuclei. 2B and 2D are insets taken from 2A and 2B, respectively, to properly illustrate the expression of CB2r-GPR55 receptor heteromers in microglial cells. Cortical neurons also expressed heteromeric complexes made of CB2r and GPR55 receptors. Panels 1A–1B were taken from control samples whereas panels 2C–D belong to suicide cases. Scale bars are 800 μm for low-magnification panels and 10 μm for insets. Panel 3A–3D: Identification of CB2r-GPR55 receptor heteromers in layer V cells of the PFC cortex of control samples (3A–3C) and suicide patients (3D–3F). CB2r-GPR55 heteromers were observed both in neurons (labeled as N) as well as in glial cells (G; presumed astrocytes). Scale bar is 10 μm in all panels

Article Snippet: Relative CB 2 r A isoform and GPR55 gene expression levels were measured using Taqman Gene Expression Assays (CB 2 r A isoform primer pair and probe were as follows: forward, GGAAGAAAGAGAATATTGTTCAGTTGATT, reverse, GCTGGCCTTGGAGAGTGACA, MGB Taqman probe, CCAGATGCAGCCGC; GPR55 Mm02621622_m1) [ 45 ] as a double-stranded DNA-specific fluorescent dye and performed on the StepOne Sequence Detector System (Applied Biosystems, Madrid, Spain).

Techniques: In Situ, Ligation, Expressing, Control, Labeling